prox1 creert2

JCI

Prox1-CreERT2 Mouse Publications

To do so we conditionally knocked out Prox1 using CaMK-CreERT2 which activated Cre only in a postmitotic stage of neuronal cells, and therefore allowed us to knockout Prox1 in postmitotic neuronal cells at any appropriate timing of the hippocampal development, We demonstrate that the DG cell has cell fate plasticity between granule cell type and CA3 pyramidal cell type in the immature stage

Prox1-positive cells monitor and sustain the murine

prox1 creert2

 · A targeting vector was designed to insert an internal ribosome entry site IRES fused to a CreERT2 Cre recombinase fused to an estrogen receptor ligand binding domain coding sequence into intron 2 of the prospero homeobox 1 Prox1 gene,The construct also contains a polyadenylation signal and a neomycin neo resistance cassette downstream of the IRES-cre/ERT2 fusion protein,

022075

Prox1-CreERT2 Mouse

Mouse; Toggle navigation

For excision of floxed alleles using the Prox1-CreERT2 line tamoxifen 20 mg/mL; Sigma was dissolved in peanut oil containing 10% ethanol Pregnant mice were injected intraperitoneally with 25 mg per 25g of body weight at the indicated time points, Cell culture experiments Adult human dermal lymphatic microvascular endothelial cells HMVEC-dLyAd hLEC and adult human dermal blood

Prox1-IRES-CreERT2

These transgenic mice express tamoxifen-inducible Cre recombinase, cre/ERT2, and enhanced green fluorescent protein EGFP under the control of the 2,4 kb mouse Prrx1, paired related homeobox 1, gene promoter, Transgene expression is detected in developing limbs by fluorescence, as early as E10,5, and in craniofacial areas and limbs by E17,5,

Prox1 postmitotically defines dentate gyrus cells by

Prox1 CreER Prox-1CreER T2 Prox1-CreER T2 Prox1 ert2cre Prox1 tm3cre/ERT2Gco Prox1 tm3cre/ESR1Gco: Gene: Prox1 Location: Chr1:189850232-189902911 bp – strand Genetic Position: Chr1, 95,85 cM Mutation origin: Germline Transmission: Earliest citation of germline transmission: J:125507:

 · Prox1 CreERT2 lineage tracing reveals that LECs give rise to venous endo­thelial cells in the mesenteric vessels of Slp76 –/ – mice, The hypothesis that mesenteric lymphatic vessels in SLP76-deficient mice alter identity in response to blood flow is based on their characteristic anatomical position within the mesenteric vascular bundle, It is possible, however, that SVs do not derive from

Prox1-CreERT2

 · Fichier PDF

Prox1-CreERT2 PCR

029211

Mutation details : The BAC clone RP23-190F21 is used to generate a transgene in which a cre/ERT2 fusion was inserted at the Prox1 start codon Two founders were generated and the one with complete recombination in all Prox1-expressing tissues was used for further studies The pound symbol #a is used to represent this specific unnamed line

Prox1 Targeted Allele Detail MGI Mouse

PCR for Prox1-CreERT2, Primers, 5Prox1_F: TGTCTGTGCCTCCATCTCAG, Prox1Cre_R: AGGCAAATTTTGGTGTACGG, Program, 95ºC 5 min, 30 cycles: 95ºC 30 sec – 60ºC 30 sec – …

TgProx1-cre/ERT21Tmak Transgene Detail MGI Mouse MGI

Prox1-CreERT2 Mouse; start an order , print this page , share this page, Prox1-CreERT2 Mouse Publications Prox1-CreERT2 Mouse Model Page, Filter publications by application: All, Filter publications by model type: All, Authors Date Paper Title: Citation: Model Type, Applications: Full Text : Bazigou E, et al, Mouse over for full list 2011 Genes regulating lymphangiogenesis control venous

 · Prox1-positive cells were distinct from Lgr5-positive ISCs with no observable overlap in induced Prox1-CreERT2 × R26-tdTom × Lgr5-EGFP-DTR mice Supplementary Fig 3G

A Transgenic Prox1-Cre-tdTomato Reporter Mouse for

 · For intravital confocal and multiphoton microscopy Prox1-Cre-tdTomato Prox1-Cre-tdRFP and Prox1-mOrange mice were anesthetized with medetomidine 1 mg/kg and ketamine 75 mg/kg or with 3% isofluorane and the ears were depilated with VEET cream Mice were transferred to a custom-made microscopy stage and placed into a 37°C incubator chamber installed on the microscope platform, Intravital

Origin: The Prxo1-creERT2 mouse was developed in the laboratory of Taija Makinen at the London Research Institute, A cDNA encoding tamoxifen inducible Cre recombinase CreERT2 followed by SV40 polyadenylation signal was introduced into the start codon of Prox1 in BAC clone RP23-190F21 using homologous recombination in bacteria,